ors.od.nih.gov logo and link to the ors web page

Course No. 6 "Identification of Disease Genes"

 

Problem 1

A laboratory has generated an EST library from a hemochromatosis patient and wants to identify the gene(s) causing the phenotype.

Outline:

We will follow these steps to solve the problem:

1. Compare ESTs from a hemochromatosis patient to the human genome (using BLAST).
2. Identify the gene(s) aligning the ESTs and download their sequences (using Map Viewer).
3. Identify whether the ESTs contain any known nucleotide variations (single nucleotide polymorphisms) (using dbSNP).
4. Determine whether a mutant form of the gene is known to cause a phenotype (using OMIM).

Step 1. Compare ESTs to the human genome (using BLAST):

One way to identify the genes expressing the ESTs is to compare their sequences using BLAST with the human genome assembly and the genes annotated on it. To access the specialized BLAST page for searching against the human genome assembly, click on

BLAST (human genome)

Paste the EST sequence provided below in the query box of the BLAST page, select the Genome reference assembly as the database and start the search by clicking on the “Begin Search” button.

Query EST Sequence:
 

TGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTGAACTACTACCCCCAGAAC
ATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGAC
CTACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTACCAGGTGGAGCACCCAGGCCTGGATCAGC
CCCTCATTGTGATCTGGG

Name the chromosome that we get as a BLAST hit. Is the EST sequence 100% identical to the genomic sequence? Note the nucleotide difference between the two sequences.

Paste your results in the window below:

Result: The EST sequence is aligned to NC_000006.11 (chromosome 6) with one nucleotide difference (G to A with respect to the nucleotide 26093141 on the chromosome).

Step 2. Identify the gene(s) expressing the ESTs and download their sequences:

To visualize the BLAST hit on the genome using Map Viewer, click on the "Human Genome View" button at the top of the results page, then on the Map element.NC_00006. Currently, four maps should be displayed (Contig, Model, RefSeq RNA and Gene_seq). Zoom out 2 or 4 times by clicking on rightmost contig map and selecting the appropriate option until you can visualize the entire gene. The BLAST hit, indicated by the red bar, is in the region of one of the exons of the HFE gene annotated on the human genome. Make the Gene_seq map the master map by clicking on the arrow at the top of the map. Display the entire HFE gene sequence by clicking on the "dl" link and then on "Display".

Result: The query EST is expressed by the HFE gene.

Step 3. Determine whether the ESTs contain known SNPs:

Use your browser’s Back button to go back to the Map Viewer. Click on the Maps and Options link.  Remove all the maps except the Gene_seq map by clicking on the – sign next to the map listed under the Tracks Displayed menu. Access the variation map by scrolling the Sequence Maps list and add that map clicking on the + sign next to it.  Use Drag to reorder, if necessary to make the variation map as the master map. Click on the OK button.

Now two maps are displayed, Variation (it's the rightmost and master map) and Gene_seq. The master map provides detailed information for the map features, in this case SNPs. Look in the BLAST hit area (red bar – you may have to zoom in). There are several SNPs in the area.  Click on the Data as Table View link.  Note the SNP rs1800562 at 26093141. Click on the link for the SNP rs1800562.

There is an A/G SNP is at the nucleotide position 26033141 on NC_00006.11. Is this the same nucleotide variation found in the BLAST result in Step 1? 

Please note that this SNP results in the Cysteine to Tyrosine mutation at position 282 for the protein (expressed by the longest mRNA NM_000410).

Result: The EST sequence contains a known SNP (G/A with respect to nucleotide 26033141 on NC_00006.11) causing a cysteine --> tyrosine mutation at position 282 for the protein (expressed by the longest mRNA NM_000410).

Step 4. Determine whether the mutant HFE gene causes a phenotype:

Click on the OMIM button in the SNP report.  It takes us to the OMIM entry for the hemochromatosis disease.  Click on the 235200 link to obtain detailed view of the entry. Click on the link to the HFE gene.  Open the Table of Contents link and click on the Table View link for Allelic variants to get information about mutant proteins from patients. Is the Cys282Tyr variant mentioned in the list? Which phenotype does it cause?

Result: Mutations in the HFE gene are associated with hemochromatosis disease.

 

Questions, Comments:  Medha Bhagwat, PhD